dynamin 2 Search Results


92
Novus Biologicals rabbit anti dynamin2
Rabbit Anti Dynamin2, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dynamin+2/10__1074_slash_jbc__m112__389452-62-12-15?v=Novus+Biologicals
Average 92 stars, based on 1 article reviews
rabbit anti dynamin2 - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

91
Addgene inc addgene plasmid
Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dynamin+2/pmc12159506-124-6-6?v=Addgene+inc
Average 91 stars, based on 1 article reviews
addgene plasmid - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier

93
Addgene inc pgfp dyn2 k44a
Pgfp Dyn2 K44a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dynamin+2/pmc07132307__pnas__1918415117__sapp-54-16-17?v=Addgene+inc
Average 93 stars, based on 1 article reviews
pgfp dyn2 k44a - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
OriGene shrna target origene sequence dnm2 cgagagcagcctcattcttgccgtcacac
Shrna Target Origene Sequence Dnm2 Cgagagcagcctcattcttgccgtcacac, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dynamin+2/pmc08833192__pnas__2112059119__sapp-245-5-7?v=OriGene
Average 90 stars, based on 1 article reviews
shrna target origene sequence dnm2 cgagagcagcctcattcttgccgtcacac - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

92
Addgene inc rfp dynamin2 k44a
Rfp Dynamin2 K44a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dynamin+2/pmc10523461__pnas__2217612120__sapp-2-117-120?v=Addgene+inc
Average 92 stars, based on 1 article reviews
rfp dynamin2 k44a - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

94
Novus Biologicals dynamin 2 antibody
Dynamin 2 Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dynamin+2/10__1074_slash_jbc__m703402200-40-42-45?v=Novus+Biologicals
Average 94 stars, based on 1 article reviews
dynamin 2 antibody - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

93
Novus Biologicals dynamin 2 rabbit
Dynamin 2 Rabbit, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dynamin+2/pmc06829668-230-30-34?v=Novus+Biologicals
Average 93 stars, based on 1 article reviews
dynamin 2 rabbit - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

86
Novus Biologicals dynamin 2 antibodies
Dynamin 2 Antibodies, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dynamin+2/10__1074_slash_jbc__m703402200-41-14-17?v=Novus+Biologicals
Average 86 stars, based on 1 article reviews
dynamin 2 antibodies - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

90
OriGene lc3b
Lc3b, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dynamin+2/pm32315611-331-2-7?v=OriGene
Average 90 stars, based on 1 article reviews
lc3b - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
OriGene human dynamin 2 plasmid
Human Dynamin 2 Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dynamin+2/pm25062814-189-0-8?v=OriGene
Average 90 stars, based on 1 article reviews
human dynamin 2 plasmid - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Novus Biologicals dynamin ii
Dynamin Ii, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dynamin+2/10__1091_slash_mbc__e17___01___0021-211-7-16?v=Novus+Biologicals
Average 90 stars, based on 1 article reviews
dynamin ii - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

93
Addgene inc net addgene
Net Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dynamin+2/pm38985670-184-47-48?v=Addgene+inc
Average 93 stars, based on 1 article reviews
net addgene - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

Image Search Results